User: Jyuh

Name: Jyuh

Joined: Sunday 21 December 2008 00:00:50 (UTC)

Last seen: Sunday 07 July 2013 14:19:57 (UTC)

Email (public): Not specified

Website: Not specified

Location: Not specified

0 Friends

0 Groups (admin)

0 Groups (member)

1 Packs

0 Favourites

Jyuh has been credited 0 times

Jyuh has an average rating of:

0.0 / 5

(0 ratings in total)

for their items

Description/summary not set

Other contact details:

Not specified

Interests:

Not specified

Field/Industry: Not specified

Occupation/Role(s): Not specified

Organisation(s):

Not specified

Note: some items may not be visible to you, due to viewing permissions.

Creator

Jyuh

View

Download

Delete unwanted DNA from plasmids

Created: 2009-02-04 06:34:43 | Last updated: 2009-02-04 15:47:23

psg5 (for HEG0 ERa, EcoR1): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3768 1021 GTAATACGACTCACTATAGGGCG AATT CGGATCCAGATCTTATTAAAGCA GAACTTGTTT Forward: 5'-ATACGACTCACTATAGGGCGCGGATCCAGATCTTAT-3' (20, 16) Reverse: 5'-TAATAAGATCTGGATCCGCGCCCTATAGTGAGTCG-3' (18, 17) pGL2 (for p15 4xSBR1, kpn1, insert: 160 bp): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3345 1 cccgggaggtaccgagctcttacgcgtgct agctcgagat ctaagtaagc 5551 ccaaactc...

0 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 8 times

This Pack has no tags!

What is this?

Linked Data

Non-Information Resource URI:

Alternative Formats