Packs

Search filter terms
Filter by tag
Filter by user
Filter by licence
Filter by group
Results per page:
Sort by:
Showing 368 results. Use the filters on the left and the search box below to refine the results.
Creator

Pack A test pack of stuff


Created: 2009-02-09 16:33:33 | Last updated: 2009-02-09 16:34:03

Testing what I can do with packs.

1 item in this pack

Comments: 0 | Viewed: 47 times | Downloaded: 28 times

Tags:

Creator

Pack Delete unwanted DNA from plasmids


Created: 2009-02-04 06:34:43 | Last updated: 2009-02-04 15:47:23

  psg5 (for HEG0 ERa, EcoR1): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3768 1021 GTAATACGACTCACTATAGGGCG AATT CGGATCCAGATCTTATTAAAGCA GAACTTGTTT Forward: 5'-ATACGACTCACTATAGGGCGCGGATCCAGATCTTAT-3' (20, 16) Reverse: 5'-TAATAAGATCTGGATCCGCGCCCTATAGTGAGTCG-3' (18, 17)   pGL2 (for p15 4xSBR1, kpn1, insert: 160 bp): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3345 1 cccgggaggtaccgagctcttacgcgtgct agctcgagat ctaagtaagc 5551 ccaaactc...

0 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 8 times

This Pack has no tags!

Creator

Pack OMERO.editor example files


Created: 2008-10-07 12:48:42 | Last updated: 2008-10-07 12:54:32

OMERO.editor is a tool for metadata editing. see the website for more details.

3 items in this pack

Comments: 0 | Viewed: 49 times | Downloaded: 12 times

This Pack has no tags!

Creator

Pack Example workflows for annotated web services


Created: 2008-09-29 11:57:45 | Last updated: 2008-09-29 13:34:14

The pack contains a number of test workflows i built when i'm annotating web services. The workflows (one or two services) have all example parameters. Cool, now you can test some web services before add them to your workflows. Do you have any workflows you built to test a service? please add them to the pack. List of myGrid annotated web services:  http://www.mygrid.org.uk/feta/mygrid/descriptions/  

1 item in this pack

Comments: 0 | Viewed: 80 times | Downloaded: 27 times

Tags:

Creator

Pack Testing456


Created: 2008-07-12 08:42:06 | Last updated: 2008-07-12 08:43:01

subpack 1

1 item in this pack

Comments: 0 | Viewed: 35 times | Downloaded: 0 times

This Pack has no tags!

Creator

Pack Testing123


Created: 2008-07-12 08:33:53 | Last updated: 2008-07-12 08:44:11

A pack that has packs

4 items in this pack

Comments: 0 | Viewed: 38 times | Downloaded: 11 times

This Pack has no tags!

Creator

Pack Isosteric transform library


Created: 2020-04-27 13:23:39 | Last updated: 2020-04-27 13:29:56

This Isostere pack contains files where isosteric transforms have been generated from a variety of sources and equivalent chemical descriptors.For example one can generate a measure of CDK molecular complexity (branching and ring order add complexity) and then find fragments , frequently occurring R-groups or small molecules that have same value. This naturally leads to well known isosteres, amongst others.

1 item in this pack

Comments: 0 | Viewed: 105 times | Downloaded: 6 times

Tags:

Creator

Pack Test


Created: 2019-10-03 17:23:53

Test

0 items in this pack

Comments: 0 | Viewed: 23 times | Downloaded: 4 times

Tags:

Creator

Pack IBISBA workflows


Created: 2018-01-28 19:40:56 | Last updated: 2018-01-28 19:43:39

Initial set of IBISBA WP7 workflows

2 items in this pack

Comments: 0 | Viewed: 10 times | Downloaded: 5 times

This Pack has no tags!

Creator

Pack Selenzyme


Created: 2017-08-18 08:23:47 | Last updated: 2017-08-23 11:12:00

Enzyme selection workflow for pathway design

2 items in this pack

Comments: 0 | Viewed: 40 times | Downloaded: 19 times

Tags:

Results per page:
Sort by: