All content

Search filter terms
Filter by category
Filter by type
Filter by tag
Filter by user
Filter by licence
Filter by group
Filter by wsdl
Filter by curation
Results per page:
Sort by:
Showing 4523 results. Use the filters on the left and the search box below to refine the results.
Uploader

Blob Authors table

Created: 2009-04-08 13:36:10 | Last updated: 2009-08-10 12:37:37

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This table contains a list of articles used to construct a list of issues with regards to the lack of systematic and explicit data analyses conducted in bioinformatcis. Each author list is linked directly to their publication within PubMed.

File type: Excel workbook

Comments: 0 | Viewed: 52 times | Downloaded: 27 times

Tags:

Uploader

Blob Table of SNP sequenceing results

Created: 2009-04-08 13:29:32

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file contains the results of re-sequencing the Daxx gene

File type: Word document

Comments: 0 | Viewed: 933 times | Downloaded: 64 times

Tags:

Uploader

Blob Candidate Gene protocol

Created: 2009-04-08 13:27:20

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This protocol provides details on how to identify candidate genes from the returned workflow results.

File type: Word document

Comments: 0 | Viewed: 123 times | Downloaded: 85 times

Tags:

Uploader

Blob A Systematic Strategy for Large-Scale Analysis of Ge...

Created: 2009-04-08 13:23:03

Credits: User Paul Fisher

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This PDF is my personal copy of the NAR publication.

File type: Adobe PDF

Comments: 0 | Viewed: 89 times | Downloaded: 70 times

Tags:

Uploader

Workflow Fetch PDB flatfile from RCSB server (1)

Thumb
Given an identifier such as '1crn' fetches the PDB format flatfile from the RCSB

Created: 2009-03-08

Credits: User Pvilaca

Workflow omim and pathways (2)

Thumb
This workflow searches OMIM for entries associated with a particular disease in OMIM, returns the IDs and maps them to Kegg Gene IDs. For each gene, it then gets the description and any corresponding pathways those genes are involved with

Created: 2009-03-03 | Last updated: 2009-11-02

Credits: User Katy Wolstencroft User Paul Fisher

Attributions: Workflow Get Kegg Gene information

Uploader

Blob Murin.owl ontology designed with Ontowiz

Created: 2009-02-17 04:45:12 | Last updated: 2009-02-17 05:00:49

Credits: User Francois Belleau

License: Creative Commons Attribution-Share Alike 3.0 Unported License

The ontology of the Murin protocol was designed with Protege Ontowiz tool.

File type: GIF image

Comments: 0 | Viewed: 67 times | Downloaded: 41 times

Tags:

Uploader

Blob Pubmed rdfiser from Bio2RDF project

Created: 2009-02-11 06:00:37 | Last updated: 2009-02-11 06:32:03

Credits: User Francois Belleau

License: Creative Commons Attribution-Share Alike 3.0 Unported License

This file is needed to use Pubmed2n3 rdfizer workflow.

File type: XML

Comments: 0 | Viewed: 82 times | Downloaded: 34 times

Tags:

Creator

Pack A test pack of stuff


Created: 2009-02-09 16:33:33 | Last updated: 2009-02-09 16:34:03

Testing what I can do with packs.

1 item in this pack

Comments: 0 | Viewed: 47 times | Downloaded: 28 times

Tags:

Creator

Pack Delete unwanted DNA from plasmids


Created: 2009-02-04 06:34:43 | Last updated: 2009-02-04 15:47:23

  psg5 (for HEG0 ERa, EcoR1): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3768 1021 GTAATACGACTCACTATAGGGCG AATT CGGATCCAGATCTTATTAAAGCA GAACTTGTTT Forward: 5'-ATACGACTCACTATAGGGCGCGGATCCAGATCTTAT-3' (20, 16) Reverse: 5'-TAATAAGATCTGGATCCGCGCCCTATAGTGAGTCG-3' (18, 17)   pGL2 (for p15 4xSBR1, kpn1, insert: 160 bp): https://www.lablife.org/pglabs?f=c&cmd=viewvecseq&vectorid=3345 1 cccgggaggtaccgagctcttacgcgtgct agctcgagat ctaagtaagc 5551 ccaaactc...

0 items in this pack

Comments: 0 | Viewed: 44 times | Downloaded: 8 times

This Pack has no tags!

Results per page:
Sort by: