Workflows

Provenance Challenge 1 workflow -- mockup ... (1)

• Download

simulates the image processing for the PC1 workflow using beanshell that simply track test strings an image is a pair (header, image) specified as a list of depth 1: [header,image] so each processor with image input takes an input list. Note that the processors are designed to operate on single images (except softmean that operates on a list of images), but because the initial input is a list of images, all are processed by implicit iteration.

Created: 2010-05-28

Credits: Paolo

Using HEK information to get DPAS data (1)

• Download

Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: Anja Le Blanc

Nucleotide FASTA to PDB file. (1)

• Download

This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: Prateek

Provenance Challenge 1 workflow part A -- ... (1)

• Download

No description

Created: 2010-06-21 | Last updated: 2010-06-21

Credits: Paolo

Provenance Challenge 1 workflow part B -- ... (1)

• Download

No description

Created: 2010-06-21 | Last updated: 2010-06-21

Credits: Paolo

Syntetic population mapper (3)

• Download

This workflow creates individual-level population from census data and then joins with the BHPS (British Household Panel Survey) and reaggregates. In the last stage it maps the chosen BHPS field.

Created: 2010-06-23 | Last updated: 2010-12-09

Credits: Alex Nenadic

Workflow for Automated Comparative Protein... (2)

• Download

This workflow performs "parallel" generic protein sequence analysis. In order to do that a list of known protein identifiers chosen by the biologist enters into the software to perform different multiple sequence alignments and finally phylogenetic analysis.

Created: 2010-06-29 | Last updated: 2010-08-31

Credits: Achille Zappa

Attributions: EBI_ClustalW_alignment_tree

Extracting data from VOTable format by usi... (1)

• Download

Input VOTable and 'name' of a Output corrosponding data of that field in an arrayInput VOTable and 'name' of a Field

Created: 2010-07-01 | Last updated: 2010-07-01

Credits: Anja Le Blanc Donal Fellows

A workflow version of the EMBOSS tutorial (1)

• Download

Designed to show the use of EMBOSS based Soaplab services from Taverna, this workflow has no inputs as all initial values are specified as string constants. A sequence set is fetched using the seqret tool, then simultaneously scanned for predicted transmembrane regions and subjected to a multiple alignment using emma. This alignment is then plotted to a set of PNG images and also used to build a profile using the prophecy and prophet tools.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Tomoinn

BiomartAndEMBOSSAnalysis (1)

• Download

Using Biomart and EMBOSS soaplab services, This workflow retrieves a number of sequences from 3 species: mouse, human, rat; align them, and returns a plot of the alignment result. Corresponding sequence ids are also returned.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: Alan Williams