1. Home
  2. Workflows

Workflows

Search filter terms
Filter by type
Filter by tag
Filter by user
Filter by licence
by-sa
1939
by
343
Filter by group
Filter by wsdl
Filter by curation
Results per page:
Sort by:
Showing 2916 results. Use the filters on the left and the search box below to refine the results.
Taverna 2
Uploader
1217?size=60x60 Gb Alan Williams

Workflow Demonstration of configurable iteration (1)

Thumb
This workflow shows the use of the iteration strategy editor to ensure that only relevant combinations of inputs are used during an implicit iteration.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: User Tomoinn

Taverna 2
Uploader
1217?size=60x60 Gb Alan Williams

Workflow BioMoby tutorial workflow (1)

Thumb
A workflow from part of the BioMoby tutorial

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: User EdwardKawas

Taverna 2
Uploader
1217?size=60x60 Gb Alan Williams

Workflow BiomartAndEMBOSSAnalysis (1)

Thumb
Using Biomart and EMBOSS soaplab services, This workflow retrieves a number of sequences from 3 species: mouse, human, rat; align them, and returns a plot of the alignment result. Corresponding sequence ids are also returned.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: User Alan Williams

Taverna 2
Uploader
1217?size=60x60 Gb Alan Williams

Workflow A workflow version of the EMBOSS tutorial (1)

Thumb
Designed to show the use of EMBOSS based Soaplab services from Taverna, this workflow has no inputs as all initial values are specified as string constants. A sequence set is fetched using the seqret tool, then simultaneously scanned for predicted transmembrane regions and subjected to a multiple alignment using emma. This alignment is then plotted to a set of PNG images and also used to build a profile using the prophecy and prophet tools.

Created: 2010-07-04 | Last updated: 2010-07-04

Credits: User Tomoinn

Taverna 2
Uploader
1253?size=60x60 Gb Anja Le Blanc

Workflow Extracting data from VOTable format by usi... (1)

Thumb
Input VOTable and 'name' of a Output corrosponding data of that field in an arrayInput VOTable and 'name' of a Field

Created: 2010-07-01 | Last updated: 2010-07-01

Credits: User Anja Le Blanc User Donal Fellows

RapidMiner
Uploader
2441?size=60x60 Fr Haddock

Workflow Holograph Reduced Representation (1)

Thumb
After Kanerwa

Created: 2010-06-29

Taverna 2
Uploader
Avatar It Achille Zappa

Workflow Workflow for Automated Comparative Protein... (2)

Thumb
This workflow performs "parallel" generic protein sequence analysis. In order to do that a list of known protein identifiers chosen by the biologist enters into the software to perform different multiple sequence alignments and finally phylogenetic analysis.

Created: 2010-06-29 | Last updated: 2010-08-31

Credits: User Achille Zappa

Attributions: Workflow EBI_ClustalW_alignment_tree

RapidMiner
Uploader
Avatar Sebastian Loh

Workflow Macro Propagation into Subprocesses and Ex... (1)

Thumb
<p> This small process demonstrates how to propagate macros into a subprocess or Execute Process operator </p> <p> When macros are set once, they are available in subprocesses imediatly (see Generate Attributes in the seconde Subprocess operator) </p> <p> If someone wants to propagate a macro into a Excecute Process operator one need to edit the "macros" parameter in the Parameters list of the Execute Process operator. </p> Tags: Subprocess, Execute Proc...

Created: 2010-06-25

Bioclipse Scripting Language
Uploader
4506?size=60x60 Nl Egon Willighagen

Workflow Resolve an InChIKey on ChemSpider (1)

Thumb
 Resolves an InChIKey on ChemSpider and opens the search results in a molecules table.

Created: 2010-06-23 | Last updated: 2010-06-23

Credits: User Egon Willighagen

Bioclipse Scripting Language
Uploader
4506?size=60x60 Nl Egon Willighagen

Workflow Downloads all Bioclipse Scripting Language... (1)

Thumb
 Downloads all Bioclipse Scripting Language scripts uploaded to MyExperiment into the Bioclipse workspace, and opens them in JavaScript editors.

Created: 2010-06-23 | Last updated: 2010-06-23

Credits: User Egon Willighagen

Taverna 2
Uploader
4011?size=60x60 Gb Alex Nenadic

Workflow Syntetic population mapper (3)

Thumb
This workflow creates individual-level population from census data and then joins with the BHPS (British Household Panel Survey) and reaggregates. In the last stage it maps the chosen BHPS field.

Created: 2010-06-23 | Last updated: 2010-12-09

Credits: User Alex Nenadic

RapidMiner
Uploader
Avatar Wluijben

Workflow Pre process data per group using recall re... (1)

Thumb
This process takes as input a dataset with different groups. For each group it discretises attributes into High, Medium, Low. This creates a group invariant representation.

Created: 2010-06-23 | Last updated: 2010-06-23

RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Discretization into Deviation Interval aro... (1)

Thumb
This process shows how numerical attributes can be discretized into intervals based on the standard deviation for each attribute around their mean values.

Created: 2010-06-22 | Last updated: 2010-06-22

RapidMiner
Uploader
1069?size=60x60 De Sebastian land

Workflow Finding all Examples that have duplicate v... (1)

Thumb
This process will retrieve all examples, who have identical values in a specific attribute. For testing, the following data can be writen into the file, that will be read by the Read CSV operator: CID,Value 3596,X 4054,X 4054,X 3000,S 3000,T 3000,U 32135,S The target of this process is to return the two examples having the same value in the CID column. To achieve this, first a real id is generated by the generate id. After this, we have to find all duplicates: For this we first remove dupl...

Created: 2010-06-18

RapidMiner
Uploader
1051?size=60x60 De Simon Fischer

Workflow Optimizing Discretization (1)

Thumb
This process generates a decision tree on the Iris data set. Before the decision tree is generated, the input attributes are discretised so we only work on nominal attributes. We use a combination of "Select Subprocess" and "Optimize Parameters" to select the best out of five different discretizazion methods independently for each of the attributes. The process shows, that the resulting accuracy heavily depends on the choice of the method. It varies between 64% and 94%.

Created: 2010-06-18 | Last updated: 2010-06-18

BioExtract Server
Uploader
Avatar Us Kendra Giesey

Workflow Phylogenetic Study Using the Bio Extract S... (2)

Thumb
This workflow, created using the BioExtract Server, contains a nucleotide query (using the NCBI Core Nucleotide Database), Blastn (against the Homo sapiens genome), Blastn (against the Mus musculus genome), the Format Conversion tool, the Fetch Translator Tool, and ClustalW. This workflow was created following the analytical steps described in the journal article "Resolution among major placental mammal interordinal relationships with genome data imply that speciation influenced the...

Created: 2010-06-17 | Last updated: 2010-07-19

Credits: User Kendra Giesey Network-member BioExtract Server for Genomics

LabTrove Template
Uploader
Avatar http://...

Workflow SDS-Page Gel (1)

 A SDS Template

Created: 2010-06-17 | Last updated: 2010-06-17

Credits: User http://thebluerhino.myopenid.com/

htm
Uploader
1843?size=60x60 It Katsiaryna Mirylenka

Workflow Unbiasing procedure (1)

Thumb
It is a workflow for description of our unbiasing procedure that is used in LiquidPub project,  "Peer Review and Reviewer Behavior" branch. The procedure is used  for conducting experiments on conference data.

Created: 2010-06-16 | Last updated: 2010-06-16

Credits: User Katsiaryna Mirylenka

RapidMiner
Uploader
1069?size=60x60 De Sebastian land

Workflow Preprocessing nominal data for frequent it... (1)

Thumb
This process will first create artificial data that can be compared to usual data loaded for frequent item set mining: Nominal Data with a true and false value, but differently mapped to internal indices. For ItemSet Mining these must be preprocessed to avoid problems: First they have to be transformed to Binominal Attributes, then it has to be defined, which is the positive and the negative value.

Created: 2010-06-16 | Last updated: 2010-06-16

Kepler
Uploader
Avatar Leidou

Workflow PI_Calculation (1)

This workflow calculates PI through multiple iterations. It shows the loop support of comad.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow BioMoby_PhylogeneticTree (1)

The workflow makes phylogenetic tree analysis by using the BioMoby services.It shows the configurability of the comad actor. Thousands of BioMoby services could be modeled by one comad actor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow BioMoby_Blast (1)

The workflow implements blast by using the BioMoby services.It shows the configurability of the comad actor. Thousands of BioMoby services could be modeled by one comad actor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_XmlInputFormat (1)

The workflow make statistic of meteorological data from one weather station. It shows the input data of comad workflow can also be in general xml format.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_UserDefinedType (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use user defined type in comad.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_TypeAlias (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use type alias in the comad.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_portReference (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use the port reference syntax in the comad path expression.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_filter (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how deletion syntax is used in the comad path expression to implement a filter actor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_creation (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to creation syntax is used in the comad path expression.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_CompositeCoactor (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use comad composite coactor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic (1)

The workflow make statistic of meteorological data from one weather station. It shows generally how  a comad workflow is built up.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow two_station_RPlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from two weather stations 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis and...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow three_station_RPlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from three weather stations 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis a...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow one_station_SequencePlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from one weather station 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow one_station_RPlotter (1)

The workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1. Collect hourly humidity data in ten days from one weather station 2. Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3. Calculate statistics of growing degree day for data in each window 4. Draw time-based trend graph for analy...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

RapidMiner
Uploader
2441?size=60x60 Fr Haddock

Workflow Function finding (1)

Thumb
This process recursively generates new attributes by mathematically combining existing attributes with user selectable operators. At the end of each pass through the recursion attributes are thinned to prevent silicon smoke and unpleasantness. Sample input. P1    P2    A1    A2    RESULT 2       3      4      5      15 6     &...

Created: 2010-06-12 | Last updated: 2010-06-29

Taverna 2
Uploader
1827?size=60x60 In Prateek

Workflow Nucleotide FASTA to PDB file. (1)

Thumb
This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: User Prateek

Taverna 2
Uploader
1253?size=60x60 Gb Anja Le Blanc

Workflow Using HEK information to get DPAS data (1)

Thumb
Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: User Anja Le Blanc

RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Same Number of Examples per Class (Stratif... (1)

Thumb
This process can be used to sample examples from each class of the data set so that the number of examples per class is the same for all classes. The name of the label attribute is defined in the first "Set Macro" operator within the subprocess "Stratification". The result will be a stratified data set where each class is represented by the minimum number of examples for a single class minus 1 (due to calculation reasons in absolute sampling which is used here). The first two operators just...

Created: 2010-06-10

RapidMiner
Uploader
Avatar Sebastian Loh

Workflow Execute Program on Windows 7 (1)

Thumb
This simple process demonstrates how to execute a program on windows 7 even if the program path contains spaces. The process will start the Internet Explore if the path exists. Tags: Rapidminer, Execute Program, Windows 7

Created: 2010-06-09

RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Transform Attribute Names to lower Case (S... (1)

Thumb
This process uses a Script operator which transforms the attribute names of the input example set into lower case.

Created: 2010-06-06

RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Transform Attribute Names to Upper Case (S... (1)

Thumb
This process uses a Script operator which transforms the attribute names of the input example set into UPPER case.

Created: 2010-06-06

RapidMiner
Uploader
1069?size=60x60 De Sebastian land

Workflow Prepending common prefix to attributes (1)

Thumb
This process shows how one can add a common prefix to a subset of attributes. First a subset might be defined by the attribute set selection parameters of the rename by replacing operator. Then one can make use of the capturing group functionality of regular expressions to insert the original name into the replacement.

Created: 2010-06-04

RapidMiner
Uploader
1069?size=60x60 De Sebastian land

Workflow Combining nominal attributes with missing (1)

Thumb
This process will show how one can combine nominal values of attributes that contain missing values. A generate attribute operator is used and hence forbidden characters must first be replaced. After this, a condition in the generation ensures that no question mark (standing for missing value) will be shown in the result, if any of the two combined attributes is known.

Created: 2010-06-04

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M5 Charge Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M5 which ionises molecules at pH 7 prior to matching, restores original structures.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M4 Tautomer Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M4 which generates canonical tautomers prior to matching, matches, then restores original structures.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M3 Non-stereo Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M3 which strips stereochemical information from molecules, performs exact matching, and restores stereochemistry.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M2 Similarity Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M2 which reads molecules from two sources and produces clusters of highly similar molecules.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow M1 Exact Matching (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithm M1 which matches fully specified molecules on the basis of their canonical representations.

Created: 2010-06-03

Credits: User Paul Dobson

Pipeline Pilot
Uploader
76?size=60x60 Gb Paul Dobson

Workflow C1 Combined Workflow (1)

The process of metabolic network reconstructions typically begins with the task of collating existing information. For metabolites this poses a relatively straight forward set of cheminformatics problems. This workflow implements matching algorithms M1-M5 in one workflow, yielding a sparse matrix of matches annotated by match types.

Created: 2010-06-03 | Last updated: 2010-06-03

Credits: User Paul Dobson

RapidMiner
Uploader
2441?size=60x60 Fr Haddock

Workflow Association rules as examples (1)

Thumb
Uses Groovy scripting to lay out rules and their support metrics as examples.

Created: 2010-06-02

Results per page:
Sort by:
Funded by: BioVeL, EPSRC, JISC, Microsoft

Affiliates: myGrid, Taverna, BioCatalogue
About | Privacy | Publications | Contact / Feedback | Mailing List
Icons: Silk icon set 1.3

Copyright © 2007 – 2018 The University of Manchester and University of Southampton