1. Home
  2. Workflows

Workflows

Search filter terms
Filter by type
Filter by tag
Filter by user
Filter by licence
by-sa
1939
by
343
Filter by group
Filter by wsdl
Filter by curation
Results per page:
Sort by:
Showing 2916 results. Use the filters on the left and the search box below to refine the results.
Kepler
Uploader
Avatar Leidou

Workflow BioMoby_PhylogeneticTree (1)

The workflow makes phylogenetic tree analysis by using the BioMoby services.It shows the configurability of the comad actor. Thousands of BioMoby services could be modeled by one comad actor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow BioMoby_Blast (1)

The workflow implements blast by using the BioMoby services.It shows the configurability of the comad actor. Thousands of BioMoby services could be modeled by one comad actor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_XmlInputFormat (1)

The workflow make statistic of meteorological data from one weather station. It shows the input data of comad workflow can also be in general xml format.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_UserDefinedType (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use user defined type in comad.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_TypeAlias (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use type alias in the comad.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_portReference (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use the port reference syntax in the comad path expression.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_filter (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how deletion syntax is used in the comad path expression to implement a filter actor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_creation (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to creation syntax is used in the comad path expression.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic_CompositeCoactor (1)

The workflow make statistic of meteorological data from one weather station. It's used to show how to use comad composite coactor.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow Statistic (1)

The workflow make statistic of meteorological data from one weather station. It shows generally how  a comad workflow is built up.

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow two_station_RPlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from two weather stations 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis and...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow three_station_RPlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from three weather stations 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis a...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow one_station_SequencePlotter (1)

Comet workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1.Collect hourly humidity data in ten days from one weather station 2.Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3.Calculate statistics of growing degree day for data in each window 4.Draw time-based trend graph for analysis...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

Kepler
Uploader
Avatar Leidou

Workflow one_station_RPlotter (1)

The workflow analyzes meteorological data coming from comet project (http://comet.ucdavis.edu/wiki/index.php/Main_Page). The main analysis steps are: 1. Collect hourly humidity data in ten days from one weather station 2. Aggregate the hourly data based on a group of time window and calculate basic statistic data, like min, max etc, for the data aggregated in each window. 3. Calculate statistics of growing degree day for data in each window 4. Draw time-based trend graph for analy...

Created: 2010-06-15 | Last updated: 2010-06-15

Credits: User Leidou

RapidMiner
Uploader
2441?size=60x60 Fr Haddock

Workflow Function finding (1)

Thumb
This process recursively generates new attributes by mathematically combining existing attributes with user selectable operators. At the end of each pass through the recursion attributes are thinned to prevent silicon smoke and unpleasantness. Sample input. P1    P2    A1    A2    RESULT 2       3      4      5      15 6     &...

Created: 2010-06-12 | Last updated: 2010-06-29

Taverna 2
Uploader
1827?size=60x60 In Prateek

Workflow Nucleotide FASTA to PDB file. (1)

Thumb
This workflow is designed to convert nucleotide fasta sequence to corresponding pdb file,which could be used for modelling. In this workflow nucleotide fasta sequence is given as input, eg. >gi|119889797|ref|XM_864887.2| PREDICTED: Bos taurus amylase, alpha 2A (pancreatic), transcript variant 2 (AMY2A), mRNA ATGAAGTTTTTTCTGTTGCTTTCAGCAATTGGGTTCTGCTGGGCTCAGTATGACCCACACGTCAAATCTG GACGGACCTCCATTGTCCATCTGTTTGAGTGGCGCTGGGTAGATATTGCTCTTGAATGTGAGCGATACTT AGCCCCCAAAGGATTTGGAGGGGTTCAGGTCTCCCCAC...

Created: 2010-06-11 | Last updated: 2010-06-11

Credits: User Prateek

Taverna 2
Uploader
1253?size=60x60 Gb Anja Le Blanc

Workflow Using HEK information to get DPAS data (1)

Thumb
Query HEK for all kinds of events and query DPAS for given instrument for data from event times.

Created: 2010-06-10 | Last updated: 2010-06-10

Credits: User Anja Le Blanc

RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Same Number of Examples per Class (Stratif... (1)

Thumb
This process can be used to sample examples from each class of the data set so that the number of examples per class is the same for all classes. The name of the label attribute is defined in the first "Set Macro" operator within the subprocess "Stratification". The result will be a stratified data set where each class is represented by the minimum number of examples for a single class minus 1 (due to calculation reasons in absolute sampling which is used here). The first two operators just...

Created: 2010-06-10

RapidMiner
Uploader
Avatar Sebastian Loh

Workflow Execute Program on Windows 7 (1)

Thumb
This simple process demonstrates how to execute a program on windows 7 even if the program path contains spaces. The process will start the Internet Explore if the path exists. Tags: Rapidminer, Execute Program, Windows 7

Created: 2010-06-09

RapidMiner
Uploader
1070?size=60x60 De Ingo Mierswa

Workflow Transform Attribute Names to lower Case (S... (1)

Thumb
This process uses a Script operator which transforms the attribute names of the input example set into lower case.

Created: 2010-06-06

Results per page:
Sort by:
Funded by: BioVeL, EPSRC, JISC, Microsoft

Affiliates: myGrid, Taverna, BioCatalogue
About | Privacy | Publications | Contact / Feedback | Mailing List
Icons: Silk icon set 1.3

Copyright © 2007 – 2018 The University of Manchester and University of Southampton